Agaricus bisporus (Lange) Imbach var. bisporus, teleomorph (ATCC® MYA-4626)

Strain Designations: FGSC 10389 [H97]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FGSC 10389 [H97]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type A1
Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTTCTAGATGGGTTGTAGCTGGCTCTTCGGAGTATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTTTCAGGTATTGGAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGGATGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGGCCATGGAATCTTTTTCCTGTTAGAGTCTATGTTATTCATTATACTCTTAGAATGTCATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTATATTCTCAACTCTCCAATACTTTGTTGTAAAGGAGAGCTTGGATTGTGGAGGTTTGCTGGCTCCTTACTTGGGGTCAGCTCCTCTGAAATGCATTAGCGGAATCGTCTGCGATCTGCCACAAGTGTGATAACTTATCTACACTGGCGAGGGGATTGCTTTCTGATGTTCAGCTTCTAATCGTCTAAGGACAATTTCTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327642 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AEOK00000000 Agaricus bisporus var. bisporus H97, whole genome shotgun sequencing project

References

Morin E, et al. Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche. Proc Natl Acad Sci USA 109: 17501-17506, 2012. PubMed: 23045686

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation