Advanced Search

Aspergillus carbonarius (Bainier) Thom (ATCC® MYA-4641™)

Strain Designations: A1102 [ITEM 5010, IMI 388653]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations A1102 [ITEM 5010, IMI 388653]
Application
Ochratoxin A producer
Biofuel (hydrocarbon production)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCACCCGTGTCTATTGTACCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCATCTCTGCCCCTCGGGCCCGTGCCCGCCGGAGACACCAACACGAACACTGTCTGAAATCGTGAAGTCTGAGTCGATTGTTTTCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTGTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACAACTCCAACCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 28S ribosomal RNA gene

ACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTTGTAAACGACCCGTCTT
Name of Depositor G Perrone
Special Collection ATCC
Chain of Custody
ATCC <-- G Perrone
Isolation
Grape berry, Brindis, Apulia, Italy.
Cross References

Nucleotide (GenBank) : GU291292 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291282 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AHIG00000000 Aspergillus carbonarius ITEM 5010, whole genome shotgun sequencing project

References

Sinha M, et al. Production of hydrocarbons by Aspergillus carbonarius ITEM 5010. Fungal Biol. 119: 274-282, 2015. PubMed: 25813514

Washington State University. "Researchers produce jet fuel compounds from fungus." ScienceDaily. Science Daily, 5 May 2015.

Perrone G, et al. AFLP characterization of southern Europe population of Aspergillus Section Nigri from grapes. Int. J. Food Microbiol. 111: S22-S27, 2006.

Perrone G, et al. Ochratoxin A production and amplified fragment length polymorphism analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger strains isolated from grapes in Italy. Appl. Environ. Microbiol. 72: 680-685, 2006.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS