Cryptococcus terrestris (ATCC® MYA-4952)

Strain Designations: HD-38  /  Product Format: frozen

Deposited As Cryptococcus terestris
Strain Designations HD-38
Application Produces pheomelanins
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Produces pheomelanins
Epidemiological study
Morphology On YM medium at 25°C after 5 days, Colonies creamy white to dingy white, mucoid, smooth, margin entire. Cells hyaline, globose to broadly ovoid, smooth, 4-5.5 X 3-5.5 µm. Pseudohyphae not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTATTGATTGGTCGAAAGACCTTATCAGATTCTACCACCTCTGTGAACCGTTGACCTCCGGGTTAATAATCAAACATCAGTGTAACGAACGTAAGAGTATCTTAACGAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTCAGTGTCATGAAATCTCAATCTAATATGTTTTCTGAACATGTTAGACTTGGACTTGGGCGTCTGCCAGTGATGGCTCGCCTCAAATGACTTAGTGGAACATCCCACATCAGTGTTAGACGTAATAAGTTTCGTCTCTCCTTGTGGTGATGACTGCTCAGAACCTGCCATCGCGCACTTTTGACTTTGACCTGAAATCAGGTAGGGCTACCC


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACTGTGTCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGCTGGAAGGTGGCACCTCCGGGTGTGTTATAGCCAGCTGTCGCATACACCGAATGAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 5 days, Colonies creamy white to dingy white, mucoid, smooth, margin entire. Cells hyaline, globose to broadly ovoid, smooth, 4-5.5 X 3-5.5 µm. Pseudohyphae not observed.
Name of Depositor R Chaunan
Chain of Custody ATCC <-- R Chaunan
Isolation Grevillea robusta, Solan, Himachal Pradesh, India.
References

Dhillon H, Sharma DR. Extracellular Deoxyribonuclease and Hemolysins Production by Cryptococcus species. Int. J. New Horiz. Pharm. Biomed. Sci. 1: 13-24, 2013.