To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Aspergillus terreus Thom (ATCC® 10690™)

Strain Designations: QM 82-j [CBS 377.64, DSM 1958, IFO 6346, IMI 321320, IMI 45543, NRRL 571, QM 82J]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations QM 82-j [CBS 377.64, DSM 1958, IFO 6346, IMI 321320, IMI 45543, NRRL 571, QM 82J]
Application
Fungus resistance testing
Fungus resistance testing paper and paperboard
Fungus resistance testing plastics
Fungus resistance testing sandbags
Fungus resistance testing textiles
Produces LL-S88 alpha
Produces antiviral agent
Produces polyamine oxidase
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 5-7 days on Emmons' modification of Sabouraud's agar at 25°C colonies yellowish to cinnamon-brown consisting of dense felt of conidiosphores. Conidial heads in compact columns; stipes smooth-walled, variable in shape, spherical to dome-like. Conidia smooth-walled, globose to subglobose.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCGGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTTGTAAACGAC
Morphology After 5-7 days on Emmons' modification of Sabouraud's agar at 25°C colonies yellowish to cinnamon-brown consisting of dense felt of conidiosphores. Conidial heads in compact columns; stipes smooth-walled, variable in shape, spherical to dome-like. Conidia smooth-walled, globose to subglobose.
Name of Depositor QM
Isolation
Haversack, New Guinea
Cross References

Nucleotide (GenBank) : KF278453 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KF278468 D1/D2 region of 28S rRNA gene

References

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Isobe K, et al. Kinetic properties of fungal polyamine oxidases and their application to differential determination of spermine and spermidine. Agric. Biol. Chem. 44: 2955-2960, 1980.

Isobe K, et al. Crystallization and characterization of polyamine oxidase from Aspergillus terreus. Agric. Biol. Chem. 44: 2749-2751, 1980.

Yamada H, et al. Oxidation of polyamines by fungal enzymes. Agric. Biol. Chem. 44: 2469-2476, 1980.

Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003.

Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS