To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X
Search

Candida kefyr (Beijerinck) van Uden et Buckley (ATCC® 4135™)

Alternate State: Kluyveromyces marxianus (EC Hansen) van der Walt  /  Strain Designations: CBS 607 [ATCC 6264, ATCC 6265, ATCC 7348, CBS 1620, DBVPG 6161, JCM 3760, NCYC 6]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida kefyr (Beijerinck) van Uden et Buckley
Strain Designations CBS 607 [ATCC 6264, ATCC 6265, ATCC 7348, CBS 1620, DBVPG 6161, JCM 3760, NCYC 6]
Alternate State Kluyveromyces marxianus (EC Hansen) van der Walt
Application
Bacterial resistance testing
Fungus resistance testing adhesives
Control strain for typing systems
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Endomyces pseudotropicalis)
Preceptrol® no
Comments
Esterase activity
Morphology On YM medium at 25°C after 6 days, colonies creamy white to dingy white, smooth to faintly wrinkled, raised, margin filamentous. Cells hyaline, smooth, ovoid to ellipsoidal, guttulate, 6-9 X 4.5 µm. Pseudohyphae abundant.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTATGAATGAATAGATTACTGGGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTAC
Morphology On YM medium at 25°C after 6 days, colonies creamy white to dingy white, smooth to faintly wrinkled, raised, margin filamentous. Cells hyaline, smooth, ovoid to ellipsoidal, guttulate, 6-9 X 4.5 µm. Pseudohyphae abundant.
Name of Depositor CBS
Isolation
Clinical bronchomycosis, Sri Lanka
Cross References

Nucleotide (GenBank) : M60303 C.kefyr small subunit ribosomal RNA.

References

Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150

Castellani A. Observations on fungi of the genus Endomyces affecting man in the tropics. Centralbl. Bakteriol. Parasitenkd. Infektionskr. I Abt. 58: 236-238, 1911.

Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J Clin Microbiol 34: 615-621, 1996. PubMed: 8904425

Kato M, et al. Phylogenetic relationship and mode of evolution of yeast DNA topoisomerase II gene in the pathogenic Candida species. Gene 272: 275-281, 2001. PubMed: 11470534

type strain of Endomyces pseudotropicalis

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS