To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Candida albicans (Robin) Berkhout (ATCC® 60193™)

Strain Designations: S-24  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Candida
Strain Designations S-24
Application
Assay of chloro-8-quinolinol
Media testing
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Morphology Colonies after 3 days cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTATGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCG
Morphology Colonies after 3 days cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains.
Name of Depositor JA Lewis
Isolation
Cervix, Illinois
Cross References

Nucleotide (GenBank) : KU729049 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AX109677 Sequence 410 from Patent WO0123604.

Nucleotide (GenBank) : U95784 Candida albicans strain ATCC 60193 ERK/MAP protein kinase (ERK1)

References

Lentz DL, et al. The anticandidal properties of chlorinated 8-quinolinols. Mycologia 88: 651-654, 1996.

Quality Control for Commercially Prepared Microbiological Culture Media; Approved Standard - 3rd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M22-A3.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS