Planned maintenance

We must perform activities that will impact the ability to place orders on our website. Starting Friday, May 21, at 5:00 p.m. Eastern to Sunday, May 23, at 5:00 p.m. Eastern, you will not be able to order products on our website. You will still be able to browse atcc.org and access your account. We apologize for any inconvenience this work may cause.
X

Candida tropicalis (Castellani) Berkhout (ATCC® 66029)

Genome Data Seal Click here to learn about our Enhanced Authentication Initiative

Strain Designations: AmMS 227  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Verified By Whole-genome Sequencing
Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Candida
Strain Designations AmMS 227
Application
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTAC

Name of Depositor GJ De Leon
Isolation Not available.
Cross References

Nucleotide (GenBank) : EU266571 ITS including 5.8S rRNA gene

References

MicroScan Yeast ID QC Set. Dade/Siemens.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
FAQs
  1. Accessing genome sequencing data


    Date Updated: 9/30/2019

  2. Criteria for reference quality genomes


    Date Updated: 9/30/2019