To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Cryptococcus neoformans (Sanfelice) Vuillemin (ATCC® 66031™)

Alternate State: Filobasidiella neoformans Kwon-Chung  /  Strain Designations: AmMS 229  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations AmMS 229
Alternate State Filobasidiella neoformans Kwon-Chung
Application
Quality control strain
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Morphology Colonies white to cream-colored, mucoid, with entire margins. Cells globose-ovoid, reproducing by budding, in a few cases generating straight or branched chains of cells (sometimes elongate), ("pseudohyphae"). True septate hyphae produced under some conditions (by diploid strains).
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAAG


D1D2 region of the 28/26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGA
Morphology Colonies white to cream-colored, mucoid, with entire margins. Cells globose-ovoid, reproducing by budding, in a few cases generating straight or branched chains of cells (sometimes elongate), ("pseudohyphae"). True septate hyphae produced under some conditions (by diploid strains).
Name of Depositor GJ De Leon
Cross References

Nucleotide (GenBank) : EU240002 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729172 D1/D2 region of 28S rRNA gene

References

MicroScan Yeast ID QC Set. Dade/Siemens.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS