Search

Vanrija humicola (Daszewska) Moore (ATCC® 9949™)

Strain Designations: NRRL Y-1266 [CBS 2041, IFO 0753, JCM 1459, NBRC 0753]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida humicola (Daszewska) Diddens et Lodder
Strain Designations NRRL Y-1266 [CBS 2041, IFO 0753, JCM 1459, NBRC 0753]
Application
Produces lipase
Produces lipases active at pH 5.5 and 7.5
Quality control strain
Produces thermostable, nonspecific lipase
Quality control strain for API and bioMerieux VITEK products
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Alkali-tolerant at pH 10
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCCTTAGTGGCTAAAAACTATATCCCAAACACCTGTGAACTGTTGAATCGCGTCTTCGGATGTGATTCTTTTACAAACATTGTGTAATGAACGTCATAACATTATAAACAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGATCTCTCAACCAATAGGGTTTCTTATTGGCTTGGATCTGGGTGTTGCCAGCTTTGTCTGGCTCGCCTTAAAGGAGTTAGCGAGTAAAGCTCTGTCGTCTGGCGTAATAAGTTTCGCTGGTGTAGACAGTGGTGGCGCACGCTTATAATCGCCTTCGGGCAATTTTTGACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCGTCTTTCAGGCGTCCGAGTTGTAATCTATAGAAGTGTTTTCCGTGCTGGACCATGTCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACATGACCACCAGTGCTCTGTGATACACTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCATTGGACTCAGCCGGTTTTCGGTGTATTTCCTTTGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGCAGGAAGAAAGTGGCTCCCTCGGGAGTGTTATAGCTTTCTGTCACATACACTGGAGGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC
Name of Depositor NRRL
Isolation
Culture contaminant
References

Ishii M. Thermally stable and positionally non-specific lipase isolated from Candida. US Patent 5,273,898 dated Dec 28 1993

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

Hou CT. pH dependence and thermostability of lipases from cultures from the ARS Culture Collection. J. Ind. Microbiol. 13: 242-248, 1994.

API ID 32 C. bioMerieux.

Sugita T, et al. Phylogenetic and taxonomic heterogeneity of Cryptococcus humicolus by analysis of the sequences of the internal transcribed spacer regions and 18S rDNA, and the phylogenetic relationships of C. humicolus, C. curvatus, and the genus Trichosporon. Microbiol. Immunol. 44: 455-461, 2000. PubMed: 10941928

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS