To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Zygosaccharomyces parabailii Suh et al. (ATCC® MYA-4549-MINI-PACK)

Strain Designations: VITEK 301705 [MUCL 51627]  /  Product Format: frozen
6 ready-to-use vials of ATCC® MYA-4549™ in glycerol stock

Permits and Restrictions

View Permits

Deposited As Zygosaccharomyces bailii (Lindner) Guilliermond
Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Zygosaccharomyces
Strain Designations VITEK 301705 [MUCL 51627]
Application ATCC® MYA-4549-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® MYA-4549™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping.  Learn more about ATCC® MinisDeveloped by the leaders in microbial cultivation and preservation, ATCC® Minis provide a convenient, ready-to-use solution for handling quality control strains. ATCC® Minis are authenticated and backed by ATCC polyphasic testing – ensuring the same consistent and reliable reference materials you’ve come to trust for ATCC Genuine Cultures®. It is easy to ensure the quality of your products with ATCC® Minis – just open, plate, and go!

Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
6 ready-to-use vials of ATCC® MYA-4549™ in glycerol stock
Storage Conditions -70°C or colder, store upright
Type Strain no
Preceptrol® no
Comments
Quality control strain for VITEK® 2 Yeast Identification Card.
The strain was re-identified as Zygosaccharomyces parabailii based on the multigene sequence comparison.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
LSU rDNA of MYA-4549

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAAAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC


ITS of MYA-4549

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAAATTTCTGATTGACGAGTCTGGAGCAGTTGTGTTCTTTCTGTTTTTTTTAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAGCATAGTTGCTTTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCGCTTCCAGAGGTAAACACAAACAATTTTTTTTATTTTATTTTATTTTATTATTATAATAATAATAATACAGTCAAAACGAATACTAAAACAAAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTATTATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGC

Name of Depositor bioMerieux, Inc.
Special Collection ATCC® Minis
Chain of Custody
ATCC <-- bioMerieux, Inc.
Cross References

Nucleotide (GenBank) : KC678106 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC678081 polymerase II second largest subunit (RPB2) gene

Nucleotide (GenBank) : FJ914902 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914883 ITS including 5.8S rRNA gene

References

Suh SO, et al. Proposal of Zygosaccharomyces parabailii sp. nov. and Zygosaccharomyces pseudobailii sp. nov., two new species closely related to Zygosaccharomyces bailii. Int. J. Syst. Evol. Microbiol. 63: 1922-1929, 2013. PubMed: 23524351

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation