Candida parapsilosis (Ashford) Langeron et Talice

22019 ^™

Download Genome Learn about the ATCC Genome Portal

An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.

Product category: Fungi
Product type: Yeast

Preceptrol culture
Strain designation: CBS 604 [CCRC 20515, DBVPG 6150, DMS 5784, IBL 2545, IFO 1396, IGC 2545, JCM 1785, NBRC 1396, NCYC 601, NRRL Y-12969, UCD 61-27]
Type strain: Yes
Genome sequenced strain: Yes
Isolation source: Case of sprue
Geographical isolation: United States; Puerto Rico
Applications: Industrial biotechnology

Quality control
Product format: Freeze-dried
Storage conditions: 2°C to 8°C

See Additional Product Information

Price: $84.00 EA

Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

Product sheet

Application note

Characterization data

BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

General

Specific applications: Assay of itraconzaole

Assay of ketoconazole

Control strain for identification

Degrades hydroxybenzoate

Degrades phenol

Produces (S)-1,3-butanediol dehydrogenase

Produces lipase

Quality control

Quality control strain

Susceptibility disc testing

Susceptibility testing

Antifungal susceptibility testing RefGhannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.

Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing
Preceptrol: Yes

Characteristics

Comments: Esterase activity
Electrophoretic karyotype
RAPD profiles

This organism is a CLSI control strain for antimicrobial susceptibility testing.

Handling information

Medium

ATCC Medium 200: YM agar or YM broth

ATCC Medium 325: Malt extract agar (Blakeslee's formula)

ATCC Medium 28: Emmons' modification of Sabouraud's agar/broth

Temperature

30-35°C

Atmosphere

Aerobic

Handling procedure

For freeze-dried (lyophilized) ampoules:

Open an ampoule according to enclosed instructions.
From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
Aseptically transfer the suspension back into the test tube of sterile distilled water.
Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
Incubate the inoculum at the propagation conditions recommended.
Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

Handling notes

Type strain of the species; used for assay of itraconzaole, assay of ketoconazole, control strain for identification, degrades hydroxybenzoate, degrades phenol, produces (S)-1,3-butanediol dehydrogenase produces lipase, quality control, and susceptibility testing.
Quality control strain for bioMerieux VITEK 2 products.

This organism is a CLSI control strain for antimicrobial susceptibility testing.

Additional, updated information on this product may be available on the ATCC^® web site at www.atcc.org.

Quality control specifications

Sequenced data

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTGAACCTGCGGAAGGATCATTACAGAATGAAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTTTCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAATGTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA

D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCG

Verification method

Whole-genome Sequencing

History

Deposited as: Candida parapsilosis (Ashford) Langeron et Talice
Synonyms: Monilia parapsilosis Ashford, Candida osornensis Ramirez et Gonzalez, Brettanomyces petrophilum Takeda et al., Candida parapsilosis var. intermedia van Rij et Verona
Depositors: CBS
Chain of custody: ATCC <-- CBS <-- BK Ashford
Cross references: GenBank KU729052 ITS including 5.8S rRNA gene

GenBank M60307 small subunit ribosomal RNA

GenBank L11352 5.8S ribosomal RNA gene, sequence

GenBank U45754 26S ribosomal RNA gene, partial sequence

GenBank U46004 Candida parapsilosis ribosomal RNA large subunit gene sequence.

GenBank U10987 5.8S rRNA gene and internal transcribed spacers 1 and 2, complete sequence

GenBank AF085429 ADP/ATP carrier protein gene, nuclear gene encoding mitochondrial protein, complete coding sequence

Legal disclaimers

Intended use

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.

Warranty

The product is provided 'AS IS' and the viability of ATCC^® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150

Ashford BK. Certain conditions of the gastro-intestinal tract in Porto Rico and their relation to tropical sprue. Am. J. Trop. Med. Hyg. 8: 507-538, 1928.

Lott TJ, et al. Genomic heterogeneity in the yeast Candida parapsilosis. Curr. Genet. 23: 463-467, 1993. PubMed: 8319303

Briand D, et al. Functioning and regioselectivity of the lipase of Candida parapsilosis (Ashford) Langeron and Talice in aqueous medium. New interpretation of regioselectivity taking acyl migration into account. Eur. J. Biochem. 228: 169-175, 1995. PubMed: 7883000

Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J Med Vet Mycol 34: 293-297, 1996. PubMed: 8873891

View All Curated Citations for this Product

Need assistance with this product? Contact our Technical Support team.

Email

Send us a message

Telephone

US and Puerto Rico

800-638-6597

Outside the US

+1-703-365-2700

Hours of Operation

Monday-Friday

9:00am - 5:00pm
US Eastern Time