pENTR_L4R1_BetI-pCYC1MIN
SB-1055 ™
pENTR_L4R1_BetI-pCYC1MIN contains an ATCC synthetic promoter flanked by two Gateway® recombination att sites (attL4 and attR1). The promoter consists of the TetR homolog Bet1 operator sequence (ATTGATTGGACGTTCAATATAA) and a yeast CYC1 minimal promoter. It can be activated by the ATCC synthetic activator BetI-VP64 (ATCC® SB-1094™). This promoter is part of the ATCC® Synthetic Biology Yeast Tool Kit (Detailed information is described in the ATCC® Synthetic Biology Solutions User Guide). Gateway® is a registered trademark of Thermo Fisher Scientific