pENTR_L1L2_ BM3R1
SB-1086 ™
pENTR_L1L2_L BM3R1 contains the BM3R1 gene (TetR homolog) flanked by two Gateway® recombination att sites (attL1 and attL2). BM3R1, a transcriptional regulator from Bacillus bacteria, can repress gene transcription by binding its cognate operator sequence (CGGAATGAACGTTCATTCCG) and occluding polymerase activity. This regulator is part of the ATCC® Synthetic Biology Yeast Tool Kit (Detailed information is described in the ATCC® Synthetic Biology Solutions User Guide). The synthetic promoter pGPD- BM3R1 (ATCC® SB-1066™) can be paired with this regulator to control gene expression in Saccharomyces cerevisiae. Gateway® is a registered trademark of Thermo Fisher Scientific.