Candida albicans (Robin) Berkhout

10231 ^™

Download Genome Learn about the ATCC Genome Portal

An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.

Product category: Fungi
Product type: Yeast
Classification: Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Candida
Strain designation: 3147 [CBS 6431, CCY 29-3-106, CIP 48.72, DSM 1386, IFO 1594, NCPF 3179, NCYC 1363, NIH 3147, VTT C-85161]
Type strain: No
Genome sequenced strain: Yes
Isolation source: Man with bronchomycosis
Applications: Agricultural research

Antimicrobial resistance research

Drug development

Food testing

Media testing

Quality control

Pharmaceutical testing
Product format: Freeze-dried
Storage conditions: 2°C to 8°C

See Additional Product Information

Price: $288.00 EA

Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Select specific lot(s)

Please enter the quantity for the selected lot number and add to cart.

Please fill at least one quantity field.

Quantity should not be greater than inventory.

Quantity	Lot Number	Inventory	Donor Age	Donor Sex	Donor Ethnicity	Donor BMI	CoA

Documentation

Product sheet

Characterization data

BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

General

Specific applications: Assay of amphotericin B fungizone

Assay of antimicrobial preservatives

Assay of haloprogin

Assay of nystatin fungicidin

Media testing

Membrane filter testing

Preparatory test control

Produces D-arabinolactone oxidase

Produces DNA topoisomerase

Food testing

Pharmaceutical and Personal Care

Produces aspartic proteinases aspartyl proteinases

Produces estrogen-binding protein

Produces lanosterol synthase 2,3-oxidosqualene lanosterol cyclase

Produces phenethyl alcohol

Produces polyamine oxidase

Produces tryptophol

Quality control strain

Sterility testing

Environmental monitoring
Preservative efficacy testing
Growth promotion testing
Bioburden testing
Microbial limit testing
Antimicrobial effectiveness testing
Disinfectant testing
Aseptic processing

Testing fungicides

Produces farnesoic acid, an autoregulatory substance capable of regulating morphological transition

Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)

This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified.
Recommended as a test microorganism for EP 2.6.1 Sterility
Recommended as a test microorganism for EP 2.6.12 Microbial Examination of Non-Sterile Products: Microbial Enumeration Tests
Recommended as a test microorganism for EP 2.6.13 Microbial Examination of Non-sterile Products: Test for Specified Micro-organisms
Recommended as a test microorganism for EP 2.6.27 Microbiological Control of Cellular Products
Recommended as a test microorganism for EP 5.1.3 Efficacy of Antimicrobial Preservation
Recommended as a test microorganism for JP 16 4.05 I Microbiological Examination of Non-sterile Products: Total Viable Aerobic Count
Recommended as a test microorganism for JP 16 4.05 II Microbiological Examination of Non-sterile Products: Tests for Specified Micro-organisms Recommended as a test microorganism for JP 16 4.06 Sterility Test
Recommended as a test microorganism for JP 16 5.02 Microbial Limit Test for Crude Drugs
Recommended as a test microorganism for JP 16 G4 Microorganisms: Preservatives-Effectiveness Tests
Recommended as a test microorganism for USP <1072> Disinfectants and Antiseptics
Recommended as a test microorganism for USP <2021> Microbial Enumeration Tests
Recommended as a test microorganism for USP <51> Antimicrobial Effectiveness Testing
Recommended as a test microorganism for USP <61> Microbiological Examination of Nonsterile Products: Microbial Enumeration Tests
Recommended as a test microorganism for USP <62> Microbiological Examination of Nonsterile Products: Tests for Specified Microorganisms
Recommended as a test microorganism for USP <71> Sterility Tests
Recommended as a test microorganism for AENOR UNE-EN 1275: Chemical disinfectants and antiseptics - Quantitative suspension test for the evaluation of basic fungicidal or basic yeasticidal activity of chemical disinfectants and antiseptics - Test method and requirements
Recommended as a test microorganism for ASTM E640: Standard Test Method for Preservatives in Water-Containing Cosmetics
Recommended as a test microorganism for ISO 11930: Cosmetics — Microbiology — Evaluation of the antimicrobial protection of a cosmetic product
Preceptrol: No

Characteristics

Serotype: A
Morphology: On YEPD agar after 2 days at 25°C, colonies are cream-colored, shiny, and smooth. Older colonies show filaments-like structure at the margin and may have ridges or folders. Cells are ovoid (3.0-6.0 x 4.0-8.0 µm), budding, mostly singly and rarely clustered in young culture. Cells will elongate and form chain-like branched pseudohyphae in older culture.
Comments: Genome sequencing strain (Xiamen Medical College, China)

For sterility testing, not more than five passages from the ATCC culture should be used

Growth and invasiveness in mouse

Steroid interference with antifungal activity

Cell wall hydrophobicity enhances corticosterone incorporation

Ultraviolet microscopy

Calcification

Morphology and physiology of strain sectors

Use of impedance for preservative efficacy testing

Fungitoxicity of alcohols and fatty acids

Esterase activity

Lipid composition

Effect of antineoplastic drugs

Handling information

Medium

ATCC Medium 200: YM agar or YM broth

ATCC Medium 28: Emmons' modification of Sabouraud's agar/broth

ATCC Medium 1245: YEPD

Temperature

24-26°C

Atmosphere

Aerobic

Handling procedure

For freeze-dry (lyophilized) ampoules:

Open an ampoule according to enclosed instructions.
From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
Aseptically transfer the suspension back into the test tube of sterile distilled water.
Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
Incubate the inoculum at the propagation conditions recommended.
Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

Handling notes

This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified; For sterility testing, not more than five passages from the ATCC culture should be used; Purified genomic DNA of this strain is available as ATCC 10231D-5™.
Additional, updated information on this product may be available on the ATCC^® web site at www.atcc.org.

Quality control specifications

Sequenced data

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAA

Verification method

Whole-genome Sequencing

History

Deposited as: Candida albicans (Robin) Berkhout
Synonyms: Monilia pinoyi (Castellani) Castellani et Chalmers; Endomyces albicans (Robin) Vuillemin; Candida claussenii Lodder et Kreger-van Rij, anamorph; Candida stellatoidea (Jones et Martin) Langeron et Guerra, anamorph
Depositors: CW Emmons
Chain of custody: ATCC <-- CW Emmons <-- Wright
Type of isolate: Human
Patient gender: Male
Cross references: GenBank KU729138 D1/D2 region of 26S rRNA gene

GenBank D86430 Candida albicans gene for CaRho1, complete cds.

GenBank AX109674 Sequence 407 from Patent WO0123604.

GenBank X56867 C. albicans gene for secretory aspartate proteinase.

GenBank AF031229 Candida albicans alternative oxidase (AOX1) gene, complete cds.

GenBank U38534 Candida albicans alpha-tubulin (TUB1) gene, complete cds.

GenBank L22737 Candida albicans inositol-1-phosphate synthase (IN01) gene, complete cds.

GenBank AF031228 Candida albicans D-arabinono-1,4-lactone oxidase (ALO) gene,

GenBank U40454 Candida albicans topoisomerase type I (CATOP1) gene, complete cds.

GenBank EU266569 ITS including 5.8S rRNA gene

Legal disclaimers

Intended use

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.

Warranty

The product is provided 'AS IS' and the viability of ATCC^® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

United States Veterinary Permit for Importation and Transportation of Controlled Materials and Organisms and Vectors

For every order of this item, you must provide a valid Permit for Importation and Transportation of Controlled Materials and Organisms and Vectors (VS Form 16-6A) obtained from the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Service. Note: These are considered live cultures, not diagnostic or analytics samples. We cannot ship this item until we receive this permit.

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Lingappa BT, et al. Phenethyl alcohol and tryptophol: autoantibiotics produced by the fungus Candida albicans. Science 163: 192-194, 1969. PubMed: 5762768

Skowronski R, Feldman D. Characterization of an estrogen-binding protein in the yeast Candida albicans. Endocrinology 124: 1965-1972, 1989. PubMed: 2647470

Connolly P, et al. The use of impedance for preservative efficacy testing of pharmaceuticals and cosmetic products. J. Appl. Bacteriol. 76: 68-74, 1994. PubMed: 8144407

Klig LS, et al. Comparison of INO1 gene sequences and products in Candida albicans and Saccharomyces cerevisiae. Yeast 10: 789-800, 1994. PubMed: 7975896

ASTM International Standard Test Method for Preservatives in Water-Containing Cosmetics. West Conshohocken, PA

View All Curated Citations for this Product

For product-related inquiries and issues, contact Technical Service:

Message Us

Send us a message

Hours of Operation

Monday - Friday

9:00am - 5:00pm
US Eastern Time