pENTR_L1L2_LitR
SB-1089 ™
pENTR_L1L2_LitR contains the LitR gene (TetR homolog) flanked by two Gateway® recombination att sites (attL1 and attL2). LitR, a transcriptional regulator from Vibrio bacteria, can repress gene transcription by binding its cognate operator sequence (TGACAAATTTATAAATTGTCA) and occluding polymerase activity. It is one of regulators in the ATCC® Synthetic Biology Yeast Tool Kit (Detailed information is described in the ATCC® Synthetic Biology Solutions User Guide). A synthetic promoter, pGPD-LitR (SB-1069®), is available for pairing with this regulator for the control of a gene expression in yeast Saccharomyces cerevisiae.