pENTR_L4R1_pGPD-QacR
SB-1071 ™
pENTR_L4R1_pGPD-QacR contains an ATCC synthetic promoter flanked by two Gateway® recombination att sites (attL4 and attR1). The promoter consists of the TetR homolog QacR operator and a strong yeast GPD promoter. It can be repressed by QacR (TetR homolog) via binding of QacR to its cognate operator sequence (CTTTAGTATAGAGACTGAGCGGTCGGTCTATA) within the promoter. This promoter is part of the ATCC® Synthetic Biology Yeast Tool Kit (Detailed information is described in the ATCC® Synthetic Biology Solutions User Guide). Gateway® is a registered trademark of Thermo Fisher Scientific.