pENTR_L1L2_QacR
SB-1090 ™
pENTR_L1L2_QacR contains the QacR gene (TetR homolog) flanked by two Gateway® recombination att sites (attL1 and attL2). QacR, a transcriptional regulator from Staphylococcus aureus, can repress gene transcription by binding its cognate operator sequence (CTTTAGTATAGAGACTGAGCGGTCGGTCTATA) and occluding polymerase activity. This regulator is part of the ATCC® Synthetic Biology Yeast Tool Kit (Detailed information is described in the ATCC® Synthetic Biology Solutions User Guide). The synthetic promoter pGPD-QacR (ATCC® SB-1071™) can be paired with this regulator to control gene expression in Saccharomyces cerevisiae. Gateway® is a registered trademark of Thermo Fisher Scientific.